Friday, April 5, 2019

Market Development Strategy Implementation For MS

Market Development Strategy Implementation For MSMarks Spencer is the UKs crystalise retail merchant and is listed in the FTSE 100 of capital of the United Kingdom Stock Ex agitate. The company has nailed its course in legion(predicate) diverse global food grocery salt aways. The organization has its intersections and services in the food, clothing, hosing, and financial service employmentes. The subsidisation is base on the military control strategies employ by the watertight to go up its tune in the on-going global and domestic market. The assignment is based on how the reservoir analyzes individual harvest telephone line (Strategic Business Units) and their everyplace all(prenominal) blood by using communication channel tools like Stakeholder Analysis, Porters 5 Forces Analysis, Value Chain Analysis, BCG matrix and Ansoff Matrix. After collecting the requisite date from the respective commerce tools the date is processed and employ to draw current B usiness Strategies for MSs businesses. at a time the business strategies be drawn then the author tail end contain plans on how to apply them in MSs businesses. The natural business strategies will help MS to purify their business processes and help them to expand their businesses in bargon-ass markets.Marks Spencers has numerous strategic intends to achieve its muckle. They atomic number 18 the number wizard retailers in UK so the management has adopted sore milestones on how to conduct business by causing little monetary range to the environment. They hasten necromancerted their project Plan A in which the faithful will try to minimize the price to the environment as less as possible by their business processes. One of the most authorised milestones is to champion alive nodes and gain sassy customers for their increases, for which they puzzle special offers and schemes in form of membership cards, sluttish shipping charges in domestic market and discoun ts during special occasions for their loyal and sore customers. They hurl started conducting their business online with help of hot ICT systems which has helped them increase their sales and serve their customers more effectively and efficiently. They in like manner have more quality controls and strategies to improve their business processes and maintain their position in domestic and international markets.Marks Spencer has vi main headings which ar Profit Maximization, Increase Sales, Market Leadership, Offering High Quality Services, festering and final payment Shareholders. Profit Maximization is the most important objective of MS. The management has made plans to maximize their wampums by increase their revenues from all several(predicate) business ventures and by cutting their cost by avoiding wastage of resources (raw material, labor, etc). Marks Spencers profit in last two forms was in 2009 it was 506.8 m and in 2010 it was 523.0 m. Increasing Sales is also o ne of the most important business objective of MS. In order to increase sales they have expanded their business ventures globally by entering freshly markets and by upgrading their products with quality controls and tests they are competent to fit their existing customers and appeal clean customers for their different business ventures. MS is open to increase its overturn from 8,164.3 m in the form 2009 to 8,567.9 m in the year 2010. Market Leadership is one of the business objectives of MS, MS is the overlargest retailer in UK and so one of its business objectives is to maintain market leadership by constant reviewing of their previous performance and of their competitors. They have drawn plans on how to become the leaders of international markets by diversifying and improving their products according to the peck of the topical anaesthetic customers. MS has made constant efforts to compete with the local competitors in international markets and their international turnov er has increased from 897.8 m in the year 2009 to 968.7 m in the year 2010. High Quality Services is one the business objectives of MS, they have always maintained a spicy standards in quality of goods and services which has kept them on top of the UK retailers for many decades. The management is making bran- youthful plans on how to evaluate and improve their services and goods to maintain their last standards to which other companies can compare and improve their performances. branch is one the important business objectives of MS as the management understands the importance of harvest-time that is if the sign of the zodiac doesnt get under ones skin it will not survive in todays competitory markets. Marks Spencer has made maximum expansions from the year 2001 after a parvenu board was setup. MS has expanded its business by giving liberty to local people in different countries and has successfully expanded its business in more than 35 countries globally. Reward Sharehol ders is also an important business objective since its a listed public company in London Stock Exchange. It is in FTSE 100 list and like all the other companies MS has declare dividends each year based on their profits in order to keep a healthy birth with their shareholders. The shareholders are the backbone as they have invested commodious amount of liquid wealth through IPOs in MS to allow the theater to carry out its business with calculated risks.The Threat of Entry is one of the key areas in which the truehearted requires unique strategies on how to stop the new-fangled wholes from entering their market portion. The family either has slash down their prices to an extend that new hards cannot enter their market or have much(prenominal) a strong stigmatise value that the customers stay loyal to their products. MS is able to maintain its stigma loyalty and maintain itself as UKs number one retailer giant. MS has planned a grand term system for outgrowth which hinde rs new firms to enter in its market segment. The firm is thus successfully in this area of business. The Power of Buyers is the area of business that deals with how the firm satisfies its customers with products which are of better quality and are at lower price range. The customers have the bargaining power as there are large retail giants like Tesco, Sainsbury, Asda (Wal-Mart), etc to cater their needs. The quality and price range of MSs goods and services is still better than the nap retail giants so they are able to keep customers loyal to their products. The Power of Suppliers is the area in which the firm deals with its suppliers for its raw material. MS has supplies only from local suppliers and since they are few in number MS has less negotiation power. The suppliers of MS enjoy the power of controlling price of the raw materials. This is one area where the firm can really improve its business process by shifting their manufacturing units to places where the number of suppl iers is more and they can have a better chance of bargaining with their suppliers. The Threat of Substitute is area of business that deals in planning on how to avoid customers from switching into new products. MSs management and RD department are responsible in upgrading their products so that the customers remain satisfied and not switch over to an alternative product made by its rivals. The RD department is so efficient in its work that not only they are able to satisfy their existing customers but also attract new customers to their product line. Competitive Rivalry is the area of business in which the firm keeps a close check on its rival firms and plans on how to compete with them in a hawkish market in a profitable manner. MS is able to maintain heights standards of goods and services which allowed them to stay as the largest retail giant till date in UK.MS has apply the BCG matrix from time to time and have used the data wisely. The matrix has helped them to penetrate in new and old markets with various new products and services. The products of MS are able to capture huge markets in amply growing industries. MS has a diverse range of products and services so they have allocated their resources in the star products. They have opened many new outlets in prime areas for retail and helped their move mark products in becoming star products. MS has expanded their business globally so their star products are able to capture new markets easily. MS management has minimized their dog SBUs and has diversified those funds towards star products. This has helped the firm to be at the top of the retailers in UK and a major competitor in other international markets. Currently MS has only cash cow and star SBUs in market. The cash cows are not giving much return due to the recession and slow growth of global market but the star products are doing exceptional hearty because of their high reputation.The BCG matrix helps the firm understand their products disembod ied spirit cycle and allocation of resources in the SBUs. BCG matrix has been one of the most important business tool for MS in analyzing their performance from time to timehttp//www.scribd.com/ atomic number 101/24329524/Introduction3.2 Ansoff MatrixIgor Ansoff had invented the Ansoff Matrix in 1941 and was scratch line published in 1957 in Harvard business review. The Ansoff Matrix is a strategic merchandise tool that links a firms marketing strategy with its general strategy and outlines the options open to the firm if they wish to grow, improve profitableness and revenue. These options indicate to how to manage the extendment of the product range. It mainly presents four alternative growth strategies in a table (matrix) which are market penetration, market ascendment, product development and diversification.Market incursion is a growth strategy for existing products in existing market. The company tries to increase its market share by increasing the sale of its existing product in its current market by using new marketing strategies. Market Development is a growth strategy for underdeveloped new markets for existing products. The main objective is to find new markets domestic or international for the firms existing product. Product Development is a growth strategy for new product in existing markets. The firm has to develop new products and launch them in their current market to capture market share. Diversification is a growth strategy for new products for new markets. The firm has to launch new products for new markets in order to expand their business in different markets. This is one of the most important growth strategy as the company has to study the taste of new customers and design their products in order to capture market share of a new market.Marks Spencer uses Ansoff Matrix to analyze their overall business portfolio. Since MS is one of the largest retailers in global market they use all the four growth strategies of Ansoff Matrix in their business. Market Penetration is used by MS to attract customers and make them loyal to their brand by offering good quality and services. They have special offers and customer loyalty programs during special occasion which helps them to attract new customers. The firm has opened many outlets in their captured markets in order to increase sales of their existing products. Product Development is one of the main growth strategies used by MS, the firm develops it new products according to the change in fashion. This has helped the firm to grow rapidly over the years. Market Development is also a growth strategy practiced by MS as they are expanding their business globally. The firm has opened many new outlets in many other countries over the world. Their products have such high demand that they are able to expand their business in many countries. MS is a cash rich company therefore it can easily capture new emerging markets by opening new outlets at prime areas in different counti es. Diversification as a growth strategy is also used by MS as they develop new products for new customers to cater their needs. The RD department of MS is highly efficient in developing new products for new targeted markets of the firm. MS when enters new market they modify or make their products according to the taste of their new customers.MS uses both Ansoff BCG Matrix to analyze their business processes and to draw up business strategies for growth in existing and new markets. The analyzed data is used effectively by the management and MS is growing its business over the years successfully.Develop evaluate possible alternative strategies for the organisation you have chosen.4. Alternative Strategies GrowthGrowth strategies are adopted by companies when they try to win large market share, even at the expense of short-term earnings. The growth strategies can be classified into four types and they are market penetration, product development, diversification and market developme nt.Marks Spencer also has to use alternative strategies to grow their business in this competitive world market. The management has to use all of their resources to plan new strategies on how to utilize their current products, current markets, new products and new markets, in order to hold back there is maximum business growth.4.1 Alternative Strategies used by Marks SpencerMarks Spencer uses a mixture of many strategies to draw up plans for growth. MS having a diverse business can use many strategies to expand their business in domestic and in international markets. The strategies used are market development strategies, market penetration strategies, product development strategies, and diversification strategies.4.1.1 Market Development StrategiesMarks Spencers management can grow their business by using market development strategies in which they can expand their business in new countries. The products of MS are of high quality therefore their reputation can help the firm eas ily grow into new markets. The brand value of MS can even help the firm to venture into new market segment and attract new customers as the products are of good quality and are placed at competitive prices. The food, clothing and house ware businesses of MS can use this strategy to grow and reap huge benefits for the company.4.1.2 Product Development StrategiesMS uses Product Development Strategy for its house ware, food and clothing business. In food business MS has changed the packaging to cater the needs of customers who buy in bulk and in small quantity. In clothing line they introduce a new collection according to the change in fashion to attract customers to their clothing business. House ware being the largest business the firm is founding new products frequently to remain at the top of other retailer in UK.4.1.3 Market Penetration StrategiesMS uses Market Penetration strategies for all of existing businesses. This strategy has helped MS to remain at the top of all the retai lers in UK. The clothing and food business use strategies like customer loyalty and value improvement strategies whereas the hose ware and financial service businesses use market share growth strategies to grow business.4.1.4 orthogonal Related Diversification StrategiesRelative diversification is the development of a new product line for the new market. Related diversification is of two types crosswise and vertical. Horizontal diversification is development of a product which is an alternative to your current product and Vertical diversification is when the company becomes its own supplier or distributor.Unrelated diversification is the development of a new product which has no relation to the market or the sedulousness in which the firm conducts its current business.MS uses relation diversification strategies for its food and clothing business. For both businesses it uses horizontal diversification strategy by which it develops new food and clothing products as per the change in taste and trend of the people. Recently MS has started its business in Financial Service area this is a cop new business therefore the growth of these services are planned by unrelated diversification strategies. Therefore the firm has used many strategies to diversify and expand its business in order to prolong in the competitive market.The selection of strategies by the management has helped the firm to reap exceptional benefits and has helped the firm to maintain its position at the top of all the retailer giants in UK. The strategies used in global markets have also been successful and the growth rate of the firm is tremendous in foreign markets. The products and services are of high net worth therefore the firm can easily use the planned strategies to grow their business in local and international markets.Outline an implementation plan for the chosen strategies in question 4.5. Growth Strategies Implementation for Marks SpencerMany of the plans for the strategic growth d iscussed before are already use by the firm. New plan for expansion in new markets (market development) is to be drawn and implemented to ensure strategic growth for clothing business.5.1 Market Development Strategy Implementation for MSMS has to develop and implement strategic plans for capturing markets in different countries. MS has already expanded its business in many countries and their products are capturing huge market shares. Seeing tremendous international growth MS should capture new markets as their products are of good quality. The new markets will help the clothes business grow internationally and MS brand image will further appreciate. The steps for planning market development strategies are planning, organization structure, human resources, annual business plan, monitor lizarding and control and linkage.Planning is the first step for developing a market developing strategies. The firm has to first decide which new market they should capture and what product line th ey should launch for their new market segment. A detailed research on the taste of their new customers needs to be conducted and then accordingly the firm needs to launch their existing or new product line. Organizational Structure needs to be resolved by the firm before they layout their business foundation in the new market. Usually the firm gives franchise to the local people to open new store in new countries, this step helps in minimizing risk and the management is in the hands of the franchise holder. The firm still has control over the layout of the store and pricing of the products. Human Resources of every new store is taken care by the franchise holder but MS organizes workshops to train and help the workers to develop new skills. This helps MS to have employees which can cater the need of their customers effectively. Annual Business Plan helps the firm to estimate or forecast their sales in the new market. The firm and the franchise holder have to allocate resources acco rding to the annual business plan in order to ensure business growth. monitor Control is a crucial step in making the new business successful. MS has to monitor how the employees are trained to serve their new customers. The firm has to check if the products are properly displayed in their new stores. They have to carry out regular surveys to check the preference of the people and develop new products based on the analysis of the data collected. The firm has to give franchise to the people who will conduct business ethical or else their brand value will decline in that market segment. Linkage is when the firm keeps a close check on all the activities and makes sure that all the processes are conducted in the decided sequence regularly to ensure business growth.LinkageMS can use this growth strategy to develop a new market and by implementing this strategy it can grow its business in many part of the world. One of the business objective of MS is to grow therefore growing in internat ional market is really profitable as MS has made constant efforts to compete with the local competitors in international markets and their international turnover has increased from 897.8 m in the year 2009 to 968.7 m in the year 2010. The international market of MS has shown a tremendous growth and so MS should make full use of this plan and grow its business in new markets. This plan also gives the firm the advantage of developing new products for their new market segments. The brand image has helped the firm to grow in many new markets therefore MS should utilize this growth strategy to develop new markets. oddmentQuinn (1980, pg. 3) defines Business Strategy as the pattern that integrates an organizations major goal, policies and action sequences into a cohesive whole. A well formulated strategy helps to marshal and allocate an organizations resources into unique and viable posture based on its relative internal competencies and shortcomings, anticipated changes in the environmen t and contingent moves by intelligent opponents.The author has used many business measuring tools (BCG Matrix, Ansoff Matrix, Porters 5 Forces Analysis, Value Chain Analysis, Stake holder analysis, etc) appropriately to collect relevant data on each of the SBUs and on overall business. The data was processed and used to form new alternative growth strategies for MS. The growth strategy if used by the firm can help them expand their business and also to develop new product lines for new markets. Therefore the business strategies suggested by the author in the assignment are relevant for the firm if they want to grow their business in current global market and retain their position at the top of UKs retailer list.Reference ListBooks ReferredMooij, M, 2009. worldwide Marketing and Advertising, 3rd Edition. SAGEJohn, R, Gillies, G, 1996. Global Business Strategy. Cengage Learning EMEA.Johnson, 2008. Exploring Corporate Strategy. Pearson Education India.Johnson, G, Scholes, K, Whittingt on, R, 2006. Exploring Corporate Strategy, seventh Edition. Financial Times.Websites ReferredHistory Introduction of MS taken (online), Available at http//corporate.marksandspencer.com/aboutus/company_overview (Accessed 15th April, 2011)Mission Vision taken (online), Available at http//www2.marksandspencer.com/thecompany/our_stores/world.shtml (Accessed 15th April, 2011)Definition of Strategic Intent taken (online), Available at http//dilipnaidu.wordpress.com/2010/05/06/strategic-intent/ (Accessed 15th April, 2011)Objectives of MS taken (online), Available at http//bizcovering.com/major-companies/a-case-study-on-marks-and-spencer/2/ (Accessed 15th April, 2011)MS 5 long time Records taken (online), Available at http//corporate.marksandspencer.com/investors/fin_highlights/five_year_record (Accessed sixteenth April, 2011)Stakeholder Analysis taken (online), Available at http//www.businessdictionary.com/definition/stakeholder.html (Accessed 16th April, 2011)Porters 5 Forces Analysis ( online), Available at http//www.1stessays.com/samples/businessanalysis.pdf (Accessed 16th April, 2011)BCGs Matrix taken (online), Available at http//www.managementstudyguide.com/bcg-matrix.htm http//www.scribd.com/doc/24329524/Introduction (Accessed 17th April, 2011)Ansoff Matrix taken (online), Available at http//www.ngfl-cymru.org.uk/ansoff_matrix-2.pdf http//www.businessdictionary.com/definition/Ansoff-matrix.html (Accessed 17th April, 2011)Alternative Growth Strategies taken (online), Available at http//www.businessdictionary.com/definition/growth-strategy.html http//paulcurtis.files.wordpress.com/2011/03/growthstrategymatrix.jpg?w=500h=446(Accessed 17th April, 2011)

Thursday, April 4, 2019

An enquiry into the use of Assessment for Learning

An enquiry into the use of Assessment for LearningSince the Education right Act (1988), introduced study testing to monitor school standards of statement estimation has continued to play a major lot in the educational delivery in schools. Assessment encompasses alone aspects of t from individually one that measure the level of didactics through students discernment and achievement. Assessment is not just end of category examinations but an on-going process that should be present in teaching at all times in prepare for lessons to be effective. by dint of some(prenominal)(prenominal) studies (Assessment Reform Group (ARG), 2002 Black et al, 2003 Clark, 2005) it has become evident that through careful intendning of mind it is potential to incite students encyclopedism and indigence, by using a more(prenominal) formative procession as opposed to high stakes testing of summative evaluatement.It is often noted that teachers ask questions to check students visiting of the lesson but take a simple acknowledgement as a valid indication that schooling has occurred. Students are often not confident or giveing to identify themselves as not understanding. It is at that propof most-valuable for teachers to carefully plan strategies for legal opinion both formative and summative to identify what students name ingestt to plan for future lessons (Capel, Leask Turner, 2009). It is important to call for different formative appraisal methods and their suit qualification to the study objectives or circumstance culture styles of students. Kyriacou (1998) suggested that supporting acquire activities with assessment should be of a more subtle approach.This enquiry will focalisation on various methods of AfL that can be employed by a teacher in order to raise students attainment, motivation towards education and engagement throughout lessons. AfL plays a central role in teaching and pupils learning, providing continual feedback to students on th eir level of attainment, where they are succeeding and where they need to improve, giving them development on how to progress further. Through AfL, we as teachers submit continual advice and feedback in the forms of positive reinforcement to occasionive discourse through doubting, to enable students to demonstrate a deeper understanding of the subject promoting cognitive development. This study will focalise on the use of AfL within the chosen building block of spend a penny as the Office for Standards and education (Ofsted) (2005, 2008a) determine, AfL as the weakest part of teaching and learning, in particular a weak area for student physical education teachers (Ofsted, 2003). It is of key Importance as a student teacher to understand the application of AfL, as several studies have place that the use of assessment is key in developing future learning opportunities having an restore not just on their attainment but also their attitude to learning, their engagement with t he school subjects and their motivation to do well (Black and William, 2001 Black et al., 2003).This enquiry will instruction on the delivery of a year 7 boys dance scheme of figure delivered over six lessons. When planning the unit of work several factors including knowledge of the learners ability, my knowledge of the subject, curriculum knowledge and pedagogical knowledge were all place as aspects of a teachers personal subject construct. It is important as a teacher to not al deplorable your personal constructs and views of a subject to exclude pupils with different views, (Banks et al., 1999 cited in Capel, Leask Turner 2009).A framework was provided by the school indicating the learning objectives for each lesson and progression over the unit of work. Through discussion with members of staff with previous experience of delivering the unit of work it assistanceed to increase my subject knowledge and ideas for achievable learning activities to incorporate into my lessons. The study school had a well-structured pupil assessment strategy modelled from the national curriculum level descriptors (appendix 1), which was key in designing learning objectives and provided a clear indication of what the students should be working towards. With this information and a brief overview of the classes ability it was possible to start designing the learning objectives for the unit of work. It was important to ensure that my learning objectives were varied across the key processes of physical education to ensure students could demonstrate and develop a variety of skills not merely there physical ability as Ofsted (2002 cited in Capel) raised concern over the weakness in pupils skills of mirror image and evaluation due to limited chance to develop these skills.. The study school had a big focus on incorporating learning objectives into normal lessons based on Personal Learning and Thinking Skills (PLTS) to develop these skills as well as a focus on PLTS in year 7. Th ey clearly understand the enormousness of raising students abilities as team workers, independent enquirers, reflective learners, independent enquirers, creative thinkers, egotism-managers and effective participants in order for students to access the curriculum and progress with greater success as laid out by the PLTS matter Curriculum Framework (QCDA 2011).When planning to integrate AfL into lessons it is key to acknowledge the ten search based principles of AfL identified by the ARG (2002) into classroom based practice (Appendix 2). As suggested by Black et al (2003) the implementation of ad hoc assessment strategies can increase students learning, increase motivation and enthusiasm towards a subject. Spackman (2002 cited in Capel and Whitehead 2010) identified four characteristics of AfL in relation to physical education as shared learning objectives, wondering(a), feedback and pupil companion and self-assessment. The sequence of lessons were planned to incorporate an a spect of all four assessment strategies to ensure all students were provided with an opportunity to gain a further understanding of their learning and to provide a wider spectrum of tools to identify students level of ability. apiece lesson was structured in three phases, the initial being the identification of a new skill or recall of previously learnt skills providing opportunity for sharing learning objectives and questioning, the second phase would be a accomplishment where students would practice ad rehearse the newly learnt skill under the teachers guidance which provided opportunity for feedback, questioning and self/ peer assessment and finally the third phase of appreciation where students would focus on peer assessment providing feedback to each other. The lessons focused on the key processes identified in the Key stage 3 depicted object Curriculum for Physical Education.Throughout the delivery of lessons it was not always possible to follow the unit of work as students had not always made sufficient progress to move onto the next learning phase. hence lessons were modified based on the previous learning that had occurred to continue the progression smoothly and to ensure learning objectives were not too demanding for the learners. The importance of AfL in forming objectives for learning was emphasised in a report by Ofsted where the chief inspector wrote Accurate assessment is used to identify focused objectives for learning and is a solid ground for choosing suitably challenging tasks and resources (Ofsted, 2007).Through the delivery and observation of the first lesson it was clearly identified that effective questioning was used to recap on learning from previous lessons, to ensure student understanding of learning tasks, and to assess students understanding and accomplishment of learning objectives. It is important to question a variety of students not always the ones with hold up as several studies have suggested adopting a no hands up pol icy in which all students are then required to formulate an answer as to the teacher will woof randomly and to ensure students understand that the an incorrect answer is part of learning and they should not be appalled to ask questions themselves to gain clarity. This also provided opportunity for students to discuss with their peers to formulate a possible answer which is secure for learning to occur (DfES, 2007). Other search identified that questions needed to be related back to the learning objectives, and to use more open ended questions as suggested by Clarke (2005). Although there was opportunity for peer assessment in the appreciation phase of the lesson this needed to be refined with the use of assessment criteria as identified by Latham (1992 cited in Mawer 1999, pp 242) who noted that in order for peer assessment to work pupils need help in focusing on the specific areas of a skill or process to be assessed. This was after supported by Loose Abrahams (1993 cited in M awer 1999, pp 242) who identified that pupils need clear instruction on what to focus on when assessing as shown in the example assessment sheet, (Appendix 3).Over the course of the following lessons the use of questioning significantly improved combining the use of open ended and directed questioning to recall forward learnt information and assess the students level of understanding as suggested by Clarke (2005). Learning Objectives were shared with students and discussed at the start-off of the lesson, however the use of questioning could be improved to re-iterate the learning objectives throughout the lesson. Several strategies were used to promote self/peer assessment. One involved students completing a self-assessment sheet (Appendix 4) to identify what they had learnt in front lessons and also to evaluate what they learnt by the end of the lesson, using a traffic animated system for each question as an alternative questioning method to quit greater classroom involvement ( Clarke, 2005). Although the core of this assessment has the potential to be a valuable tool it needed to be pitched at a more suitable level to work. Due to the students lack of understanding as to why they were doing it, their ability level and learning style the teaching strategy did not match the leaners personality or information impact level as suggested by Harvey, Hunt and Schroders (1961 cited in Mawer 1999, pp 143) Conceptual systems theory. Based on this research it was noted that maybe due to their low conceptual complexity in terms of information processing they required a simplified system supported by a more structured approach from the teacher as they had not yet developed the capability to generate ideas in a low structured environment (Joyce and Weil, 1986 cited in Mawer 1999, pp 144). This is supported by further research that identified that formative assessment can only work if students are trained in the skills of self-assessment and questioning so they underst and why they are doing it and what they need to do to achieve (Black William 2001). As the National Curriculum key stage 3 (assessment pack) states it is at KS3 where students start to take initiative and make decisions for themselves and PLTS are introduced, therefore a careful sense of balance between more structured direct and non-direct teaching styles is needed until these skills are embedded. The use of the traffic light system also provide the teacher with the opportunity to level the class and split the students into groups of differing ability and work on differentiated tasks (Appendix 5). Students were provided with opportunity to assess and provide feedback with the use of video cameras to record and analyse their executing. It was important to provide instruction on what the students should be looking for with reference to the learning objectives when peer assessing as suggested by Loose Abrahams (1993 cited in Mawer 1999, pp. ).The study later identified through obs ervations that when lesson objectives were shared with the class it was important to distribute students learning styles, when providing information and guidance on what they might be looking to observe and demonstrate in order for students to achieve the desired learning outcomes. The teacher adopted the Visual, Auditory or Kinaesthetic (VAK) construct (Dryden Vos, 2001 cited in Capel, Leask and Turner, 2009 , pp.262), to implement when planning and delivering (Appendix 5). Throughout lessons various stimuli were used including ocular aids by displaying learning objectives, posters and using video footage (Appendix 5).The teacher incorporated practical inferences to explain what they were looking for as opposed to the earlier descriptively heavy verbal instructions, providing students with more time to actually rehearse and practise the new skills and more time working collaboratively in groups. Through observation it was evident that the use of video footage and practical demo nstration had a large impact on the students understanding when used to identify learning goals (appendix 5). As research suggests it is of particular help when learning outcomes are shared in a format that the pupils can understand (ARG, 2002 Black et al 2003 Clarke, 2005). The use of video recording and ICT was also used to provide students with the chance to fix their own performances allowing opportunity for peer self-assessment. It is important for students to be able to assess themselves and others in order to have a clear picture of how to move forward and achieve (Black Williams 2001).For effective learning to take place teachers must carefully plan structured opportunities for students to develop the skills needed to comprehend a task, analyse feedback, self-assess their performance and be creative in solving problems through the use of AfL. As often as possible learning opportunities should be delivered with consideration of the students learning style for the greatest level of understanding to occur. The implementation of visual aids especially the use of ICT had a big impact on the students comprehension of tasks and motivation towards learning new skills, developing their ability to analyse a performance and provide structured feedback to their peers. It is clear that Spackmans (2002) four characteristics of AfL provide a basis for planning and implementing AfL strategies but further planning needs to go into how each characteristic is delivered within a lesson to cater for various academic abilities and learning styles. By including an aspect of all the charateristics in a lesson you are able to motivate, enthuse and help drive students forward. The key to successful teaching comes from the use of AfL on a daily basis to ensure students know what they are trying to learn by sharing learning objectives, helping students recognise success by sharing learning outcomes, providing a success criteria and identify the reasoning as to why they are lea rning it (DfES, 2007). It is also important to consider that this must be communicated in a way that is understood by the student (ARG, 2002 Black et al 2003 Clarke,2005). In future planning the use of questioning needs to be carefully evaluated and planned to provide opportunity for higher order thinking in line with Blooms Taxonomy. Learning Objectives, outcomes and feedback all need to be provided in a language and format that the learners can access, whether it be verbal through use of pictures or video analysis. It is of utmost importance to ensure students are developing the learning and thinking skills in lessons to allow them to access their education alongside the academic objectives of lessons.Word Count 2448Reference ListAssessment Reform Group (ARG) (2002) Testing, motivation and learning online Cambridge University of Cambridge Faculty of Education. ready(prenominal) from http//www.assessment-reform-group.org/TML%20BOOKLET%20complete.pdf Accessed 5th January 2011Black, P., Harrison, C., Lee, C., Marshall, B. and Wiliam, D (2003) Assessment for Learning place it into Practice, Maidenhead Open University Press.Black, P., and Wiliam, D. (2001). Inside the Black Box, online capital of the United Kingdom Kings College. on tap(predicate) fromhttp//weaeducation.typepad.co.uk/files/blackbox-1.pdfClarke, S., (2005) Formative Assessment in challenge Weaving the Elements Together. London Hodder and Stoughton.Department for Education Skills (DfES) (2007) Assessment for Learning 8 Schools Project Report. online London DfES Available fromhttp//c97.e2bn.net/e2bn/leas/c99/schools/c97/accounts/english/homepage/Assessment/documents/AfL/8%20schools.pdfOfsted (2003) Quality and Standards in Secondary Initial Teacher Training (HMI 546) online London GreenShires Print Group. Available fromhttp//www.ofsted.gov.uk/Ofsted-home/Publications-and-research/Browse-all-by/Education/Teachers-and-teacher-training/Routes-into-teaching/Quality-and-standards-in-secondary-initial -teacher-training Accessed February 2011Ofsted (2005) The Secondary National Strategy An Evaluation of the Fifth Year (HMI 2612) online Available fromhttp//www.ofsted.gov.uk/Ofsted-home/Publications-and-research/Browse-all-by/Education/Providers/Secondary-schools/The-Secondary-National-Strategy Accessed February 2011Ofsted (2008) Evaluation of the Primary and Secondary National Strategies 2005-2007 (HMI 070033) online Available fromhttp//www.ofsted.gov.uk/Ofsted-home/Publications-and-research/Browse-all-by/Documents-by-type/Thematic-reports/Evaluation-of-the-Primary-and-Secondary-National-StrategiesOfsted (2007) The Annual Report of Her Majestys Chief tester of Education, Childrens Services and Skills 2006/07, (HMI 20070035) online Available fromhttp//www.ofsted.gov.uk/Ofsted-home/Publications-and-research/Browse-all-by/Annual-Report/2006-07/The-Annual-Report-of-Her-Majesty-s-Chief-Inspector-2006-07 Accessed February 2011http//curriculum.qcda.gov.uk/key-stages-3-and-4/skills/person al-learning-and-thinking-skills/index.aspx).

Wednesday, April 3, 2019

Legacy of the Cold War

bequest of the parky state of warfareSana KarwanBenjamin BoyceThe Legacy of the cold warAll th approximate news report, conflicts and battles in the midst of civilizations and nations take for been inevitable. Nations have built military protections, whether they were threatened or not. Many wars have happened end-to-end our history, some small and some huge. devil of the important wars in history are the knowledge domain wars happened in the twentieth century. In reason planetary Conflict and Cooperation Intro to Theory and History by Joseph Nye and David Welch, it is menti wholenessd that the alliance placement between the countries in atomic number 63 appeared to be multipolar, then it became less invariable and Ger some rose in antecedent, the balance of power seemed less multipolar and became a bipolar system of alliance and increased the likelihood of war, which was the first human being war. later onward the First land warfare, the League of Nation was formed the main exact of the league was Collective Security. But the league failed to attain what it was established for. Although against the rules of the league, scarcely Britain and France formed an alliance and guaranteed the safety of Poland. One of the agents base on a state level of analysis was when Adolf Hitler live ons his troops to Poland and World state of war Two starts. Adolf Hitlers target was Russia, Germany had a Fascist government and USSR had a communist government. afterwards attacking the USSR by the Germans, Josef Stalin allies with the unite States and the Britain against Germany, forming the big triad. Stalin had conditions engagement this war against the Germans, which was taking all the territories he wants after the war is over. After the defeat of the Germans, the wartime allies, the US and the USSR, so quickly become enemies and the Cold contend starts. The cold war leftfieldfield the world militarized, thousands of people lost their lives, many countries financial and economic states were enamord, and the last but not the least, it left a legacy of Nuclear Weapon on the world. (Nye and Welch, 2012)The fall in States ends the guerrilla World fight by being the international policeman, fighting against communism. With the initiatives the US started, USSR started to baffle and wanted to show off his power against the US as well. The marshal Plan and the Truman Doctrine were two initiatives by the United States, one to aid europium remodel its countries that were affected by the war and the later was to in promptly fight communism. The USSR as a communist country, did not take the marshall Plan, he did not want to be indebted to the US and didnt want to show the US they need their money. Also, with the Truman Doctrine, the Republicanism/Communism war started between the two major powers of the second half of the twentieth century. (JFK subroutine library, 2015)The Cold War was the tense relationship between the Unit ed States and USSR and their allies. The war started after the Second World War ended up to the collapse of the Soviet Union, from 1945 to 1991. The bam of the war was difference in ideology of the two powers. Each one of them was onerous to convince the other who is intemperateer. Politically, the Soviet Union was fighting for Marxism and the United States for Republicanism, and economically, the USSR was supporting communism and the US was supporting capitalism. The two countries never directly confronted each other militarily, but threatened each other by nuclear weapon and fought proxy wars- using the resources of other countries to showcase power. The war defined the inappropriate policy of the two powers and was a competition of who is the superpower. (Kramer, 1999)Arthur Schlesinger based on a revisionist thesis thinks that after the Second World War, US deliberately abandoned their policy of helping and collaboration of the europiuman countries to redo europium. Exhil arated by the possession of atomic bomb, the United States undertook a stemma of aggression of self-designed to abolish the communism influence of Russia on Eastern Europe and to establish democratic and capitalist states. Truman, the US president at that time, left the Russians no alternative but to defend their boarders. On the other hand, rear end Mearsheimer claims that the absence of war in Europe since 1945 has been a consequence of three factors the bipolar distribution of military power on the continent the rough military equality between the two states compromising the two poles in Europe, the United States and the Soviet Union and the fact that each superpower was build up with a large nuclear arsenal. Mearsheimer argues that possibility for major crisis and instability in Europe was very likely after the cold war. He besides believes that Europe without the superpowers would be more than likely to suffer violence than the prehistorical 45 year. In addition to that, he considers that the anarchic nature of these two super powers over Europe pretty much defined their foreign policies. (Schlesinger, 1967) (Mearsheimer, 1990)Mearsheimer explains the Cold War as the longest period of counterinsurgency in European history. During the Cold War, Europe faced no major war according to him, only a couple of minor wars that didnt wager Europe to major war. Furthermore, he illustrates that there were major crisis in Europe during the early years of the war which again didnt not become Europe to the brink of war. He believes that home(prenominal) factors, especially nationalism caused the wars of the pre 1945 era, trance the post 1945 era, although European states were more concerned nigh peace, but domestic factors had lesser important in the international community, since distribution of military power between states had characterized Europe. Based on these assumptions, during the cold war, a militarized Europe was the result of the Cold War. (Mear sheimer, 1990)I inter visited my father about the military influence of the Cold War. He told me that based on what I have film about the Cold War is that after the Second World War the USSR had influenced and Controlled much of Eastern Europe, and the United States took that into consideration, that they didnt want that communism view to spread more. They didnt confront each other militarily, but the world was in a psychological war because of these two superpowers. The influence of the Cold War reached Africa, central Asia and the Middle East, specifically Egypt, Pakistan, Afghanistan, Iran and Iraq. The Cold War left a legacy of heavy militarization of the World that there was no national or international security. The US and the USSR developed far more advanced nuclear weapons than the Hiroshima experience. The countries under the Soviet Union were oppressed, there was no democracy in Russia, and the Soviet Union was so busy in aiding the country and other countries that were a gainst the US militarily led to the collapse of the USSR. When I asked him about the Iraq-Iran war in the 1980s and the influence of the Cold War, he recalled that although the Iraq was under the circle of the Soviet Union, but the United States was helping Iraq indirectly. In 1988, the US hit one of Irans airplanes in Iraq and this was an alert. Also in his opinion in Central Asia, with the establishment of Taliban and Al-Qaida, the US was helping these before long so called terrorist groups against the Soviet Union. This reminded me of the I am Malala book by Malala Yousafzaithat I read recently. As a kid, Malala recalls how the US is helping Taliban against Russia.C. Fred Bergsten talks about three global transformations to the world parsimony after the Cold War. First, the reforms in the Soviet Union and Eastern Europe, if successful, lead end the Cold War and most East-West confrontation, and will allow substantial reductions in military arsenals. Second, the salience of se curity issues will decline sharply economics will move much closer to the top of the global agenda. Third, the world economy will complete its evolution from the American-dominated regime of the first postwar generation to a state of US-Europe-Japan tripolarity. what he means by these transformations is that the role of individual states will go back to the international economic positions they supposed to have. Also, he is trying to draw our attention to a united Europe with a strong economy that will create a large market for trade. The reason he is talking about these economic roles of Europe is that the United States is in relative economic decline. During the World Wars in Europe, the United States appeared to have the largest economy that was willingly helping the European countries to rebuild Europe. (Bergsten, 1990)In conclusion, the Cold War left a huge economic and military legacy on the world. It left the world with plenty of military bases of the United States around the world. whitethorn be the economic legacy of the Cold War was not as big as the military legacy, but it took time for Europe to rebuild itself. In my opinion, the legacy of the Cold War can be apparently seen in Central Asia, especially in Afghanistan, where Al-Qaida was established in. The United States helping the terrorist group in Afghanistan against USSR hit back on them in September 11, 2001. So, the Cold War that is called to be the longest period of peace in Europe had a corrupt aftermath on the world and left the world militarized that we cannot help fixing.Works CitedBergsten, C. Fred. The Wrold Economy after the Cold War. The untested American Realism. Foreign Affairs. Council on Foreign Relations. Vol. 69, no. 3 (Summer, 1990), pp. 96-112. edge 20, 2015.Kramer, Mark. Ideology and the Cold War. Review of International Studies. Cambridge University Press. Vol. 25, no(prenominal) 4 (Oct., 1999), pp. 539-576. March 19, 2015.Mearsheimer, John. Back to the Future Instabili ty in Europe after the Cold War. International Security. The MIT Press. Vol. 15, No. 1 (Summer, 1990), pp. 5-56. March 20, 2015.Nye Jr., Joseph and Welch, David. Understanding Global Conflict and Cooperation An Introduction to Theory and History. 9th edition. February 19, 2012. March 19, 2015.Schlesinger, Arthur. Origins of the Cold War. The New American Realism. Foreign Affairs. Council on Foreign Relations. Vol. 46, No. 1 (Oct., 1967), pp. 22-52. March 20, 2015.The Cold War. John F. Kennedy Presidential Library Museum. John F. Kennedy Presidential Library Museum, n.d. March 19, 2015.I also interviewed my father.

Heteroplasmy and Response Against Azoxystrobin in Cercospora

Heteroplasmy and Response Against Azoxystrobin in genus CercosporaIntroductionThe quinone immaterial inhibitor (QoI) or Strobilurin is one of the most important antifungals use to control fungous and some Oomycetes pathogens in agricultural crops. This class of fungicide was commencement exercise isolated from a wood-rotting fungus called Strobilurus tenacellus. Several chemically modified derivatives of natural fungicide, Strobilurin A, atomic number 18 available which ar more stable, efficacious, less harmful to human and environment. These fungicides are commercially available with different names and active ingredients azoxystrobin (Syngenta), fenamidone (Bayer), fluoxastrobin (Arysta), kresoxim methyl (Cheminova), pyraclostrobin (BASF) and trifloxystrobin (Bayer) (bartlett pear et al., 2002 Vincelli, 2012).QoI fungicides confront both translaminar (across leaf blade) and weak systemic movement within the plant. all QoI fungicides pee-pee the same mode of action which dis rupt mitochondrial respiration and maintain energy production inside fungal cells (Vincelli 2012). The disruption of ATP coevals occurs because of binding of strobilurin at Qo site of cytochrome b hence preventing electron shipping from cytochrome b to cytochrome c1 (Bartlett et al., 2002).QoI fungicides are applied to control a broad wrap of plant pathogens including fungi, water molds, downy forms, powdery mildews and rusts (Vincelli, 2012). They are mainly employ as protective and healthful fungicides because of effective action against spore germination and shrewdness (Balba, 2007). The eradicative property has also been reported by preventing sporulation of fungal pathogen (Anesiadis et al., 2003). more(prenominal) than 50 species of plant pathogens repellent to QoI fungicides has been reported and there is a full(prenominal) risk of selecting insusceptible isolates in the field (Fungicide Resistant Action Committee, 2013). ternion different point vicissitude in m itochondrial cytochrome b gene has been associated with foul mechanics against QoI fungicide. The primary mechanism of foeman is by amino vitriolic substitution from genus Glycine to alanine at 143rd codon (G143A) (Bartlett et al., 2002). Other two point athletics at cytochrome b gene is the substitution of phenylalanine with leucine at position 129 (F129L) and glycine with arginine at position 137 (G137R) which confer QoI resistance (Fernndez-Ortuo et al. 2010). Another mechanism has also been identified that can bypass the blockage of electron transfer. alternative oxidase (AOX) is a strobilurin-insensitive terminal oxidase which can bypass electron transfer in Complex III and Salicylhydroxamic acid (SHAM) is an active inhibitor of AOX (Wood and Hollomon, 2003).Resistant mechanism of C. sojina against QoI fungicides is associated with a mitochondrial genome which is present in multiple copies within a angiotensin-converting enzyme cell. The coexistence of speculative and mu tated alleles in QoI resistant/sensitive locus has been reported in several(prenominal) other fungal pathogens such as Corynespora cassiicola, Collectotrichumgloeosporioides, Venturia inequalis and Mycovellosiella nattrassii (Ishii et al., 2007 Villani and cox, 2014). The proportion of wild and mutant allele in the mitochondrial genome has a major role for quantitative resistance (Villani and Cox, 2014). Protective efficacy of the full dose of azoxystrobin against powdery and downy mildew has been found to decrease as populations contained 10% resistant isolates (Ishii et al., 2007). There have been reports of loss of resistance stability in the absence of selection crush and vice versa (Fraaije et al., 2002 Ishii et al., 2007). The main objectives of this study are to i) list heteroplasmy in Cercospora sojina ii) monitor the proportion of resistant and sensitive allele in the aim of selection pressure in the laboratory and, iii) study the aesthesia of C. sojina against azoxys trobin.Materials and Methods sequester selection and development of bingle spore culturesIsolates of C. sojina were screened for resistant and sensitive allele development Taqman assay. After screening, leash isolates each having resistant and sensitive alleles were chosen for single spore cultures. Isolates were transferred to V8-RA media and grown in dark cabinet to enhance sporulation. After three weeks, casingd were flooded with water and filtered with muslin filter cloth. Water was observed under dissecting microscope to identify single spores. Sterilized needed were used to pick single spore and transferred to refreshful V8-RA plates. Culture was left at room temperature, mycelium harvested, lyophilized and DNA was extracted. radial tire development studyA nitty-gritty of two isolates 158-1 (resistant) and 312-1 (sensitive) were selected for fungicide esthesia and radial appendage study. Four different compactnesss of azoxystrobin including control were used to culture both isolates in two replications. Technical grade formulation of azoxystrobin (0.104 gm) (96% a.i. Syngenta play Protection) was used to make 100,000 g a.i./ml stock in 1 ml acetone. Serial dilution was done to make four different concentration stocks 10,000, 1000, 100 and 100 g a.i./ml. V8 media was prepared with four different concentrations (10, 1, 0.1, 0.01 g a.i./ml) by adding 1ml of respective fungicide stock in 1 lambert of media. All four media along with control was amended with salicylhydroxamic acid (SHAM) at 60 g a.i./ml.Two straight line at 90o were draw at the center of the plate. For resistant and sensitive isolates, a 5 mm mycelium disc was taken and placed at the center of amended plates in two replications. For each plate, diameters of growth were measured at the interval of 11, 21 and 30 days. Mycelium disc from amended plates was again transferred to the newly amended plate after 10 days. Diameters were measured similarly for three contemporariess.Taqman as say and Sanger sequencingThe G/C point mutation in cytochrome b gene go out be discriminated by Taqman assay consisting of two dyes. VIC can detect resistant allele C and FAM can detect sensitive allele G. verge cycle or Ct of two dyes provide be used in detecting the presence of two alleles in a single spore culture. Ct value is the cycle number at which the fluorescence generated crosses the threshold fluorescence and is inversely proportional to the amount of nucleic acid. Lower Ct indicates higher copies in the sample.Sanger sequencing testament be done to confirm the presence of both alleles in a single spore. Two primers pairs (Forward 5 CTCATTAAATTAGTAATAACTGTGGC 3 and Reverse 5 TAATACAGCTTCAGCATTTTTCTTCT 3) get out be used to amplify a part of cytochrome b gene. PCR reaction will be done in a total volume of 25 l consisting of 1.25 l (10 M) of each primer, 12.5 l of 2x Veriseq PCR intermix (Enzymatics Inc.), 1.25 l DNA and 8.5 l water and run in future(a) settings ini tial denaturation at 94 C for 2 min followed by 29 cycles of denaturation at 94 C for 20 s, annealing at 55 C for 25 s, extension at 72 C for 1 min and final extension at 72 C for 10 min.Data analysisSequences derived from Sanger sequencing will be aligned to in public available cytochrome b gene of C. sojina. The QoI resistant/sensitive point mutation locus will be observed for Heterozygosity. The proportions of resistant and sensitive alleles will be calculated based on Ct values and statistical analysis will be performed to compare among different generations.The percent growth inhibition will be calculated as (colony diameter on control media 5 mm colony diameter on fungicide amended media 5 mm) / (colony diameter on control media 5 mm) x 100. Further, radial growth of the same isolate among three generations and four different treatments will be compared statistically.Expected resultsThis study will help to explore if heteroplasmy exists in C. sojina as in other Cercospora species. The proportion of resistant and sensitive isolates determines the limit of disease, so it is important to know this ratio. In vitro assay to check the sensitivity of isolates against azoxystrobin at different concentration in a different generation will help to understand the effect of selection pressure. Further measuring stick of resistant and sensitive proportion with qPCR would help to determine the change occurred in following generations. Genetic study after fungicide treatment will also contribute in identifying changes due to selection pressure.ReferencesAnesiadis T, Karaoglanidis G and TzavellaKlonari K. 2003. Protective, curative and eradicant activity of the strobilurin fungicide azoxystrobin against Cercospora beticola and Erysiphe betae. Journal of Phytopathology 151(1112)647-651.Balba H. 2007. Review of strobilurin fungicide chemicals. Journal of Environmental Science and Health Part B 42(4)441-451.Bartlett DW, Clough JM, Godwin JR, Hall AA, Hamer M and Par rDobrzanski B. 2002. The strobilurin fungicides. Pest management lore 58(7)649-662.Fernndez-Ortuo D, Tors JA, De Vicente A and Prez-Garca A. 2010. Mechanisms of resistance to QoI fungicides in phytopathogenic fungi. International Microbiology 11(1)1-9.Fraaije B, Butters J, Coelho J, Jones D and Hollomon D. 2002. Following the dynamics of strobilurin resistance in Blumeria graminis f. sp. tritici using quantitative allelespecific realtime PCR measurements with the fluorescent dye SYBR Green I. lay down pathology 51(1)45-54.Fungicide Resistant Action Committee. 2013. List of plant pathogenic organisms resistant to disease control agents. http//www.frac.info/docs/default-source/publications/list-of-resistant-plant-pathogens/list-of-resistant-plant-pathogenic-organismsfebruary-2013.pdf?sfvrsn=4.Ishii H, Yano K, Date H, Furuta A, Sagehashi Y, Yamaguchi T, Sugiyama T, Nishimura K and Hasama W. 2007. Molecular characterization and diagnosing of QoI resistance in cucumber and eggplant fun gal pathogens. Phytopathology 97(11)1458-1466.Villani SM and Cox KD. 2014. Heteroplasmy of the cytochrome b gene in Venturia inaequalis and its involvement in quantitative and mulish resistance to trifloxystrobin. Phytopathology 104(9)945-953.Vincelli P. 2012. QoI (Strobilurin) Fungicides Benefits and Risks. The Plant Health Instructor. DOI 10.1094/PHI-I-2002-0809-0.Wood PM and Hollomon DW. 2003. A critical evaluation of the role of alternative oxidase in the performance of strobilurin and associate fungicides acting at the Qo site of complex III. Pest management science 59(5)499-511.

Tuesday, April 2, 2019

Addition to Pain Medication: Causes, Effects and Treatments

Addition to suffer medical specialty Causes, Effects and Treatments disorder Medication AddictionsAngelia HollandPeople argon handout to the touch when they are nonhing wrong with them to discombobulate a ethical dose for spite pills. People are getting more(prenominal) and more disposed to prescription drug do drugs drug(prenominal) pain pills. When doctors do not prescribe them a prescription be piddle they suspect that are abusing the pills, then they will buy them for some one and only(a). These pills will not stop when they drop an addiction sometime they horror it so drear that they eeryplacedose be consume they mix pills together and do not k like a shot the topic will be. However, pain pills misuse is a common thing now then it was in the past.No one decides to get inclined to prescription pain pills. Alienating family and friends, failing at work, and launching a sm exclusively-time criminal pull offer arent what anyone plans on when they sw on the whole ow their depression pain pill. nonpareil in five Ameri asss report misusing a prescription drug at least once in their lifetime, but the overwhelming majority lay the pills away with no lasting harm. So how does prescription analgesic abuse progress to wide-blown opioid addiction? It typically starts with a visit to the doctor for a backache or to dull pain after mental process, an accident or a sports injury. It ends with addiction.Misuse of prescription painkillers is on the rise, and experts say increasingly, its killing us (Shamus, 2013). Healthcare stick outrs read long wrestled with how best to treat patients who suffer from chronic pain, roughly 116 million in this country.No special training, skill, effort or techniques are required for pain deliver the goodsment when using narcotic painkillers. You hardly military issue a pill and soon afterward, the pain you were notioning is minify or eliminated. The fact that these painkillers work well with little effort ma kes them the commencement exercise choice for pain caution for many community. Rather than exploring different ship cigaretteal of managing pain, which take effort and whitethorn not eliminate pain to the aforesaid(prenominal) extent as the painkillers, community r individually for the pill bottle each time pain fireman is required. The ease of use and effectiveness it brings may lead some to reach for the drugs more often than is safe or necessary.While it may not be the first savvy that people take much(prenominal) painkillers, intimately notice that while they are chthonic the influence of these drugs, they are distanced from their activated pain.Painful emotions are a interrupt of ein righteousnessday life for all of us, but often we erect manage these feelings on our own or with professional function, such as counseling. However, people in carnal pain have often suffered emotional damage and are more vulnerable to the attractions of a pill that just makes it all go away. Over time, people stick to to depend on their prescription painkillers to manage their negative emotions.Painkillers thunder mug be pleasurable. Opioids, in particular, have a side effect of euphoria. This is similar to the pleasure felt when you have been prosperous or after intense tangible excitement, but it requires no such effort to attain. As people who are in pain have typically suffered an unpleasant experience that caused the pain, the pleasurable personal effects of these painkillers can have the appearance _or_ semblance like a delightful surprise. Seeking repeated experiences of pleasure with and through the addictive behavior or substance is one of the hallmarks of addiction.People with carnal pain are often very tense. Because many painkillers, such as Demerol, induce physical relaxation, they can provide welcome relief from tensity while under the influence. After a while, people can come to rely on painkillers that have this effect to provide relief from tenseness and the added pain that tension causes. Tolerance builds up quickly. Opioids can quickly cause tolerance to occur. As a result, people who regularly take these painkillers lift that they need to take higher and higher dosages of the drug they are on in order to get the same effect. In addition to physical tolerance, people develop psychological tolerance as they take desensitized to the effects of the drug. Tolerance is one of the key signs that addiction is developing.Often, people who are bonny addicted to narcotic painkillers believe they need more of the drug because their pain is getting worse. but the worsening is often a result of the painkiller use itself. The ups and downs of a developing addiction because physical behaviors such as overuse of an injured part of the body, poor posture resulting from a leave out of sensation when in positions that would otherwise be un satisfied, and a lack of run exercise that would otherwise strengthen the weak ened area (Hartney, 2011). Instead of correcting these stinking habits, the person will often just take more painkillers, creating a vicious cycle of physical go be concealed by the effects of the drugs.As people become addicted to painkillers, they experience breakup when the drug wears off. Withdrawal is very unpleasant, and it often feels like an intensifying of the very symptoms the person was trying to escape through victorious the painkillers.Pain, digestive problems and feelings of being generally unwell are common. As soon as the drug is taken, the unpleasant withdrawal symptoms disappear, and the person feels relieved of pain, relaxed, and free of tension and emotional distress. Over time, the person will choose to manage withdrawal symptoms through regularly taking more painkillers, sometimes without even realizing the withdrawal symptoms are caused by the drug itself (Hartney, 2011).The physical signs of addiction. Many times, painkiller addicts do not recognize the signs of their addiction until their behavior is pointed out to them. Painkillers can cause stocky speech and depression that they often attribute to other causes. Other physical symptoms of painkiller addiction include the inability to concentrate, lack of coordination and dizziness. Health care providers often recognize the symptoms because of declining blood pressure levels and slow, labored breathing. Narcotic painkillers overly produce constipation.In addition to the obvious physical signs that result in unusual behavior, people who are addicted to painkillers begin to exhibit other behaviors inconsistent with their usual habits. Students often begin to find more reasons to outride home from school and start to receive falling grades. Lethargy and reduced faculty levels are very common to painkiller addicts and are especially worthy when they were previously considered active and enjoyed physical activities. Appearance becomes less important to addicts, and they may begin to have money troubles that lead them to ask for loans and get undersur aspect in their bills.As a painkiller addict withdraws from the drugs, the signs of addiction become more apparent. The National Institutes of Health reports that withdrawal from opioid painkillers brings on bone aches, chills, insomnia, dissolution and vomiting. Involuntary leg movements, restlessness and muscle pain alike may be present. People withdrawing from painkillers should be medically supervised during the first a few(prenominal) days of treatment because the symptoms can be life threatening. Withdrawal from sedatives and tranquilizers can cause convulsions.Before taking pain medications, do your research Miotto of WebMD explains contract Your Risk FactorsA register of addiction to prescription medicine or illicit drugs.Addiction to alcohol or tobacco.Family history of addiction.A history of mood disorders (such as depression or bipolar disorder), anxiety disorders (including PTSD), eyeshot disor ders (such as schizophrenia), and personality disorders (such as borderline personality disorder).Look at Other OptionsPhysical therapy.Working with a psychologist to learn how to change your pain-related thoughts and behaviors. resource approaches such as acupuncture and tai chi.Those methods arent just for people who are at high risk for addiction. Theyre part of an overall pain management strategy that may include, but is not limited to, medications.Use the Medication for Its Proper PurposeIf your doctor writes you a prescription that makes your pain more tolerable, and youre using it as directed, thats OK. But if youre using it for some other reason that your doctor doesnt populate about, thats a red flag. For example, if you hate your job and youre taking the drug because you find it takes the edge off, thats a sign that you could develop a problem, says Karen Miotto, MD, an addiction psychiatrist at UCLA.Here are four model signs that you may be misusing your prescription pa inkillerYoure not taking the drug as positive(p).Youre taking the medicine for reasons other than why the doctor prescribed it.Your use of the drug has made you miss work or school, neglect your children, or suffer other harmful consequences.You havent been honest (with your doctor, loved ones, or yourself) about your use of the drug.Your doctor should work with you to limit addiction risk. She may ask you about how youre doing, give you a urine test to square up for medication, and ask you to bring in all your medications so she can cave in how many are left and where the prescriptions came from.If you feel like youre losing control over your pain medicine use, or if you have questions about whether youre becoming addicted to it, you may want to consult a doctor who specializes in pain medicine. He or she should listen to your concerns without judgment and take a well-grounded approach. For instance, if she thinks you need to get off a certain drug, she might check into switch ing you to another drug with less potential for misuse. If your doctor isnt comfortable handling your situation, consider getting a second opinion from a psychiatrist or addiction specialist, Miotto says.Pain-relieving drugs can lead to problems other than addiction. hap opiates locked away so kids, teens, and others in your home cant take them. And be extra-cautious using other prescription and over-the-counter drugs along with opiates. Certain combinations could cause you to become unconscious, stop breathing, and even die (Miotto, 2012).Thousands of Americans rely on prescription painkillers for the relief of pain and discomfort from ailments such as headaches, menstrual cramps, surgery recovery or lingering pain from an injury. Unfortunately however, for many, this reliance on medication can easily and unknowingly turn into physical dependence.The alarming fact is that the most commonly prescribed drugs including OxyContin, Vicodin, Methadone, Darvocet, Lortab, Lorcet and Per cocet, while offering relief from pain, can also cause individuals bodies to start needing the drugs in order to feel normal, and the result is the new, even more challenging situation of chemical dependency Prescriptions to pain medication can be safe when taken jibe to the doctors instructions and are carefully monitored. However, it is important to recognize that they can also be very dangerous. Remember that dependency is a disease that can exhibit itself to even the most cautious individual. Therefore, anyone who is prescribed pain medications should take extra precautions to avoid the debilitating effects a dependency can have and watch for the warning signs (Bernstein, 2013)Celeste Vaughan states it correctly when she describes addiction, When addiction takes control, Satan has a wide-open gate to enter and set up residence in your brain. He is the great justifier of all actions. He will provide you with excuses for the actions above to make you deny your addiction. The tho ughts that you used to control now have a new pilot behind the wheel. And a sneaky one at that. If you do consider getting help, he will get inside your head and tell you all kinds of horrible things. Thinks likeNo one will understand. Everyone will thing youre weak. Friends will ever trust you again. Your husband will want a divorce. Your kids will be ashamed of you. And the worst one of allIf God truly loves you, he wouldnt have let you get into this mess in the first place.. You are on a journey possibly the most difficult of your life. Dont let anyone tell you that addiction is unsufferable to overcome. Im proof its completely possible. After all, with God, all things are possible.The disease of addiction affects over 23 million Americans. It is a disease that has no cure, and that, as a society, we have just begun to understand. do fight the stigma that an addict faces by learning all you can about this disease and its affects. The physical aspects of opioid dependency impro ve after detox. But psychological addiction, temptation, and craving can last for years, even a lifetime. The truth is, most people will relapse on their way to full recovery from prescription drug addiction (Johnson, 2012).Staying on the path to health takes patience, loving relationships, and emotional resilience. People in drug abuse recovery need all the help they can get. Fortunately, tools and resources are available to help someone stay straight, and to pick them up if they stumble.Consider it pure joy, my brothers and sisters, whenever you face trials of many kinds, because you know that the testing of your faith produces perseverance. Let perseverance sack its work so that you may be mature and complete, not wanting anything. (James 12-4 NIV)ReferencesClifford M.D., of The Waismann Institute. 10/6/2003. Retrieved from http//www.medicinenet.com/script/main/art.asp?articlekey=24572Hartney, Elizabeth PhD. February 20, 2011. Retrieved from http//addictions.about.com/od/subst ancedependence/tp/painkillers.htmJohnson, Kimball, MD. supercilious 02, 2012. Maintaining Hope and Health during Drug Abuse Recovery. Retrieved from http//www.webmd.com/mental-health/drug-abuse-recovery-maintaining-hope-and-health?page=2Miotto, Karen, MD, prof of psychiatry and bio behavioral sciences, UCLA.. 2012. Pain Medication Are You Addicted? What to know about becoming addicted to pain medications. Retrieved from http//www.webmd.com/pain-management/features/pain-medication-addiction?page=2Shamus, Kristen Jordan. October 20, 2013. Pain pills can be prescriptions for addiction, death. Retrieved from http//www.usatoday.com/story/news/nation/2013/10/20/painkiller-overdoses-addiction/3107879/Vaughan, Celeste. November 5, 2012. Biblical Christian help for drug addiction. Retrieved from http//drug.addictionblog.org/biblical-christian-help-for-drug-addiction/

Monday, April 1, 2019

Effects of Hybrid Strategy on Zara UK

Effects of Hybrid St investgy on Zara UKCHAPTER ONE 1. institution 1. 1. Rationale for Chosen TopicTo pass on belligerent receipts in a luxuriouslyly hawkish securities manufacture such as a mull over foodstuff place is non an easy process, what is more difficult than that is to acquire sustain up to(p) emulous profit in like this food merchandise which as hale describe as refrain deepenable and unpredictable market. This opens the field to hold out about the rivalrous st treasuregies, and to choose the best dodging among them to come upon the objective lens of sustainable combative advantage.This seek tensi angiotensin converting enzymes on the generic wine strategies which purposeed by Michael porters beer in 1980 who set three unlike strategies which ar the pocket-sized- woo liveing schema, eminence system, and focus strategy. Porter (1980) argued that these strategies atomic number 18 the road map for the companies to achieve a sustaina ble competitive advantage, however he warned that the combining devil of these strategies volition put the fellowship in a position defined by him as Stuck in the Middle and thusly bequeath non lead a high accomplishment. However, other inquiryers in the strategic commission field such as miller and Dess (1993), Kekre and Srinivasan (1990), Faulkner and Bowman (1992) and Hill (1988) suggest that combination of two strategies would let the companies achieve a high performance, and achieve sustainable competitive advantage.Recognising the debate in the academic world suggests exploring whether covering of crossing strategy will help companies in achieving sustainable competitive advantage or non. To do this, Zara UK is chosen since it has the highest contri exactlyion to the over each revenue enhancements of Inditex, the suffer phoner, which was accounted 65.6% of the whole sales (Inditex Annual Report, 2008).1. 2. Research BackgroundInditex crowd is a Spanish commun ity and is unmatched of the largest appearance distributor groups in the world. The group was established in 1975 and opened its maiden branch in Corua city in Spain (Inditex, 2009).The international expansion of Inditex started in 1988 by openings its caudex in the UK which is now the fifth largest market of the group after France, Italy, Portugal, and Germany in terms of number of stores (Inditex Annual Report, 2008).In 2009, Inditex operates in 73 countries done 4430 stores and among those 1340 argon nether the name of Zara. In 2008, the number of Zara stores in the UK was 63 (Inditex, 2009).Inditex consists of six subsidiary companies working in the retail industry and one of them is Zara which generates the highest income in overall revenues of Inditex. Zara is the most internationalised business unit of the group and and then has the largest of chain (Inditex, 2009).1. 3. Research AimUltimately, this query manoeuvres at exploring whether hybrid strategy helped Zara UK in creating sustainable competitive advantage or not. R apieceing this force requires conducting external and internal analyses. Applied shaft of lights and their justification are given beneathThe external environss which surround Zara are analysed by developmentPESTLE tool to analyse the wallop of Political, Economical, Social, Technological, Legislations, and Environmental occurrenceors on Zara to explore weather it would formulates opportunities or holy terrors.Porters Five Forces model to analyse the competitive environment which surrounds Zara in fix up to explore the market conditions in fashion industry. primeval Competitors analysis in revise to examine the key competitors of Zara in the market to identify their similarities and differences as well as the business process in Zara.The internal environment of Zara is analysed by usingValues Chain analysis in rewrite to explore how efficiently Zara uses the correct upon chain system to create value for its client s. financial analysis in order to analyse its monetary performance from 2006 until the first half of 2009.Resource- found View analysis to determine core competences, and capabilities of Zara. proud Strategy analysis to identify the grand strategy employ by Inditex and to examine the effectiveness of this strategy.Competitive Strategy analysis in order to determine the competitive strategy used by Zara in achieving sustainable competitive advantage and analyse the effectiveness of this strategy.SWOT analysis in order to determine the internal strengths and weaknesses of Zara as well as the opportunities and little terrors that Zara faces payable to forces exist in external environment.It is believed that after conducting these analyses, it would be possible to go on a conclusion about whether hybrid strategy is effective or not in achieving sustainable competitive advantage in the UK fashion industry.CHAPTER TWO 2. LITERATURE REVIEW 2. 1. Competitive StrategyLiterature in comp etitive advantage strategy is a well developed base and many scholars such as Milles and Snows (1978) Mintzberg and Quinn (1992) Faulkner and Bowman (1995) introduced some(prenominal)(prenominal) models to explain how companies jakes achieve sustained competitive advantage. However, one of the most famous and effective model in this field was Michael Porters textile which was introduced in 1980. in this role model which is called Generic Strategy, he mention that the starchy tail achieve competitive advantage from three different bases. harmonize to Porter (2004)The two basic types of competitive advantage competitive advantage combined with the scope of activities for which the potent searchs to achieve them lead to three generic strategies for achieving above- mediocre performance in an industry address leadership, specialisation, and focus. The focus strategy has two variant, price focus and eminence focusHaving briefly described the Generic Strategies, it is necess ary to look at them in details.2. 1. 1. Cost Leadership StrategyTo achieve competitive advantage consort to Porter (1980, 2004), the troupe has to precipitate their comprise, and to achieve cost advantage at a lower place its competitors in the market. By doing this, a bon ton is able to move prices and performs above the comely performer in its industry convey to the fact that the cost for the company will be less than its rivals.The company send away succeed in its cost leadership strategy if it focuses in decreasing the overhead cost, uses a low-cost product design and transform assembly and pursuits economies of scale and so on. However, David (2005) highlighted some risks associated with applying this strategy. jibe to him, competitors may attend this strategy and growing the competition and make a head on collusion, which will drive the overall profit of the industry down (David, 2005).2. 1. 2. specialisation StrategyAccording to Porter (1980, 2004), to achieve competitive advantage, the company has to seek to be unique in its industry. In another words, gaining a competitive advantage raise be achieved by increasing the willingness of customers to pay for the company products or services that the company sell (Barney, 2007).According to Gaik (1993), in differentiation strategy, the customers look at the attributes of the products other than looking at the price. To apply this strategy, the sure has to differentiate itself in terms of its products for instance by think on the quality of the products or in terms of provided service by focusing on the delivery system by instrument of decreasing the lead or delivery magazine. Moreover, the company has to focus on the promotion and the promotion of products. The sure can also differentiate its products by competing on two cost and differentiation, by decreasing the cost and by adding value at the comparable time. One of the tools for achieving both strategies is managing the supply and value chain systems and designing, structuring, modifying and direct efficiently to add value to the products at the lowest cost possible.However, David (2005) mentioned that the risks of this strategy might be that the product or the service may not be valued enough for the customers to buy it at the price of which the company desires and/or that competitors will be able to imitate the products or services. Therefore, if a company seeks to be victoryful and sustain its advantage in the market, it should chase a creative strategy which makes difficult for competitors to imitate and replicate the products or services.2. 1. 3. Focus StrategyAccording to Porter (1980 2004), focus strategy is different than other strategies this is because this strategy aims to narrow the competitive scope in the market, requires selecting a specific segment or group and focusing on it by tailoring the strategy to an exclusive and particular(prenominal) market.This strategy has two variants whi ch are differentiation focus and cost focus. Differentiation focus aims at differentiating a segment or a group by satisfy their unusual needs and the in Cost focus, the firm seeks to achieve low-cost advantage in order to provide the products at cheap prices and the concentration is make only for a small number of the market segments. However, the risk of these strategies is that competitors can easily recognise the success and may copy them (David, 2005).Porter (1980 2004) mentioned that each strategy is fundamentally different from the other strategies in terms of creating sustainable competitive advantage. Therefore, a company has to make a choice among these strategies and does not combine them. otherwisewise, it will lead the firm to get stuck in the inwardness. He also stressed that being all things to all deal is the recipe for strategic mediocrity and if the performance is below the average, it often means that a firm has no competitive advantage at all (Porter, 1980 200 4).However, according to Porter (1980), in that respect are three circumstances where a firm can combine two strategies given in the Generic Strategies modelling First, when all of the other competitors are stuck in the middle second, when the cost is strongly requireed by share or interrelations and finally, when a firm pioneers are a major innovation. Also Porter (1980) mentioned that even under these circumstances, a firm would not be able to compete with a firm which pursues either differentiation, cost leadership or focus strategies. Therefore, according to Porter (1980), a hybrid strategy is unlikely to achieve sustainable competitive advantage.2. 2. Empirical StudiesPorters framework both back up and criticised by the scholars. For instance, Dess and Davis (1984) and Kim and Lim (1988) supported Porters claims and found that companies have to employ only one of the Porters generic strategies if their aim is to achieve high performance.On the other hand, several authors s uch as Miller and Dess (1993), Kekre and Sriniva-San (1990), Faulkner and Bowman (1992) and Hill (1988) criticised Porters claims and provided show up that the combination amongst the cost leadership and the differentiation strategy would help the company to achieve high performance in the market.For example, Miller and Dess (1993), Kekre and Sriniva-san (1990), Faulkner and Bowman (1992) and Hill (1988) demonstrated that it is not necessary to choose between one of the competitive advantage strategy in order to achieve a high performance. They argued that a company may achieve high performance against its competitors by combining differentiation strategy and cost leadership strategy. This is because integration of these strategies allows being flexible against the changes in the environment.Barney (2007) mentioned that a company can use low-cost and product differentiation strategies simultaneously and this is often expected to create sustained competitive advantage.Moreover, Mil ler and Dess (1993) mentioned that conceptualisation of Porters model enables the researcher in a strategic concern field to explore the viability of the Hybrid strategy. Miller and Dess (1993) gave an evident of Toyota and Lincoln electric automobile companies as highly successful companies which are applying the Hybrid strategy.Moreover, Wright et al. (1990) also proven that use of Hybrid strategy in apparel industry brought high financial performance.In addition, Hall (1980) explored that use of Hybrid strategy is the main reason of high successful of firms in low-profit industries.Murray (1988) proposed that firms can use hybrid strategy successfully by focusing in two areas areas of deed and functional areas. In terms of doing areas, Murray (1988) threw an argument based on the research conducted by Hayes and Weelwright (1984) and Schonberger (1982) and asserted that achieving greater market responsiveness depends on higher product quality. Using techniques such as chalk up Quality Control (TQC) and its integration with Just In Time (JIT) for schedule control and purchasing procedures are key to the success. Benefits would be reduction of cost as use of these techniques will be resulted in higher customer satisfaction. As a result, the conflict between the production and the marketing functions can be eliminated and therefore cost minimisation and price maximisation strategies can be implemented together.In terms of functional areas, conflict heroism techniques can be applied which will minimise the conflict to a point that permits the firm to pursue cost leadership and product differentiation strategies simultaneously.More recently, parcel out (2005) pointed out the changes occurred in the care techniques and the industries and stated that the market leaders in most industries are the firms whom are able to tap the customer appeal by reconciling effective mixture between differentiation and low cost. The examples of these firms include Toyota, Dell and Canon. More importantly, he underlined the fact that the success of these firms relies on the implementation of new management techniques such as Total Quality Management (TQM) of which exploded the myth that there is a trade off between high quality and low cost.Grant (2005) also mentioned about the role of the innovation in the manufacturing engineering science and the manufacturing management in producing simultaneous adjoin in productivity and quality.Thompson et al. (2005) called hybrid strategy as the best-cost provider and stressed that in order for a firm to gain a competitive advantage among the competitors it should have a lower cost than its competitors and should position its products with proficient-to-excellent attributes. They also stated that this strategy can be effective in markets where the buyers are sensitive to the price and the value and indeed the firm can position itself near the middle of the market by providing customers with either a medium quality products at below average price or by providing with high quality products at an average price. However, they warned that the firm which does not have the capabilities to integrate the upscale product attributes at lower prices compare to its competitors, the hybrid strategy would be ill-advised for them.CHAPTER triad 3. RESEARCH METHODOLOGY 3. 1. Chosen TopicThe Hybrid Strategy has been challenged by many strategic management scholars who argued that this strategy can be harmful to the companies. However, substantial amount of research showed that several companies like Toyota, Dell Inc, and so on have achieved a superior success. In order to assess whether this is trustworthy or not, this test examines the strategy of Zara in the hybrid strategy framework to determine whether it is successful or it stuck in the middle.3. 2. Research headspringIn the light of the ultimate aim, the research question of this study is to what point Hybrid Strategy can achieve a sustaina ble competitive advantage for firms in fashion retail industry in the UK. The research focuses on Zara UK which is one of the important business units of Inditex Group.3. 3. Research TechniqueThe disquisition is qualitative in nature. The exploration is based on data obtained from subsidiary sources of which include teaching that is already unruffled for other studies and documents.The main supplemental sources used in this study include reports and documents such as one-year reports, press releases and other documents published by the company as well as official statistics and other publicly available data collected by research institutions. The research did not attempt to collect a primary data due to barriers in communicating with the company as well as time limitations.3. 4. Advantages and Disadvantages of Use of Secondary ResourcesThe main advantage of using secondary data is embodied in saving time and resources.There are some disadvantages associated with the use of the secondary data in this particular study. First of all, collected information does not answer the research question fully. However, they are good enough to be relied upon to reach a conclusion.Secondly, secondary data has reliability issue as there are many resources but in some lineaments it is not possible to determine whether it is valid or not and this limits the accuracy of the analysis based on secondary data.To overcome these limitations, the coverage of the information was enlarged and multiple sources were used to improve the reliability of the data.3. 5. Quality of ResourcesZara is a leading company in the industry and have competitors. Therefore, before using the data obtained from secondary sources, it was assessed in terms of quality in order to verify whether the data is consonant with the purpose of the research and whether it is reliable and up-to-date. Quality standards were determined by identifying directions of predetermine in the resources by means of attempt ing both biased and unbiased sources, by checking the background and reputation of the provider and their level of education, and eff in their skipper career. The assessment also considered the target audience in terms of their association as a bias direction.The resources were also assessed in terms of their relevancy to the research, their readiness and usefulness in achieving targeted quality and in the analysis of judge results.3. 6. Case StudyTo enrich the quality of the research curiously in terms of its practicality and its rationality, it used empirical inquiry methods for analysis to investigate the contemporaneous phenomenon in spite of appearance Zaras real-life context. Therefore it has boundaries between phenomenon and context aimed at providing clear evidence by using multiple sources to assure quality and objectivity. In create and conducting this study, the researcher was influenced by the case study produced by Ghemawat and Nueno and published in 2003. In t heir study, the authors explained the rapid changes occurred in the fashion industry, by focusing on the global apparel chain Zara and its structure from the producers to the ultimate customers.Although this study influenced by the Ghemawat and Nuenos (2003) work, it did not depend on the case because of two reasons. First of all, the case study focuses on the corporate level and the mother company and therefore did not include the strategic planning techniques and analysis to explore the advantages of using hybrid competitive strategy. Having said that, this study made use of information about Zara provided by the case study in developing the strategic analysis.Secondly, the case study was prepared in 2003 and the facts given in that study was outdated to some extent. As this paper needs to be based on most recent data particularly for external analysis, financial analysis, current trends in fashion market, it is different than the case study provided by Ghemawat and Nueno (2003).C HAPTER FOUR 4. ANALYSIS 4. 1. External Analysis 4. 1. 1. Characteristics of Fashion retail trade 4. 1. 1. 1. Overview of Fashion Retail Market in the UKThe apparel retail market contains three main vault of heavens the womenswear sector, menswear sector and infantswear sector. According to Data Monitor (2008), womenswear sector consists of retail sale of change state for girls and women and generated 66.90% of the whole market in 2007 in the UK. The menswear sector consists of retail sale of fit out for men and boys and generated 30.90% of the whole market. And the infantswear sector includes retail sale of clothing for children between ages of 0 to 2 age of age and it accounts 2.20% of the sales generated by the whole market in the UK in 2007.According to Data Monitors (2008) report, the UK apparel retail market has the highest percentage of revenue in the Europe market value with 24.1% in 2007. The clothing market in the UK grew significantly between 2001 and 2005 when the t otal spending on robes in the UK in 2005 reached at 38.4 billion. Womens clothing sector showed the highest offset with 21% and the total value reached at 24 billion in the same year.More interestingly the clothing market has been growing even though the recession which hit the UK in October 2007 and affected most of the UK sectors.According to the subject area Statistics (2009), the sales volume in retail sector in June 2009 was 2.9% higher than in June 2008. In the non-food sector, the sales change magnitude by 2.4% and the largest add-on occurred in textile, clothing and footwear by 11.3%.Fashion is a part of the clothing and textile industry and the fashion industry is characterised by the rapid change and the high competition particularly after the year 2005 because of permission of nonsensitive access of all members of the World Trade Organisation (WTO) to the European (Lopez and Fan, 2009). This created a big opportunity for the multinational companies to invest in the UK market. Moreover, the rapid change in engine room has given the chance for companies to reduce their cost and to increase the quality of their products. In addition, companies which are intrusive to decrease their costs started to outsource their production with the companies from the countries with low-labour cost such as China, Singapore. This led the competition in the clothing industry to increase and as the competition increased, the prices went down as a result a market for Discount Apparel Retail emerged and started to grow (Datamonitor, 2008).However, in the fashion industry, customers do not consider prices but look at the quality, variety, design and the availability of the products. Due to characteristics of the market, no particular group or company dominate the market since the market is dictated by customers. In addition, due to increased competition, switching cost for the customers also diminished. This resulted in changes in the direction of competition. Today, the rules of the game in the clothing market have changed and meeting with customer expectations turned into achieving fast fashion production (Walters, 2006).Bruce and Daly (2006) describe todays fashion industry in the following wayIn fast fashion, buying activities play a crucial role by dint of supplier selection and product decision- do, and indeed, buying is arguably changing from rigorously operational to much more strategicAnd according to Walters (2008), the retailers in fast fashion can satisfy consumer expectations by the speed, variety and style of the products and by selling the products in low prices.4. 1. 1. 2. The Nature of Fashion MarketAccording to Christopher et al. (2004), there are four elements which determine the characteristics of the fashion market. These are rook life-cycles products have short life, it is often for a moment when designs catch the style. As a result, the period of selling products is very short and seasonal it could months or even weeks.H igh volatility the demand in the fashion market is rarely stable the demand may be influenced by several movers, such as the weather, movies or even footballers or pop stars. diminished predictability it is not easy to predict the desire of the market in the fashion industry, because of the volatility of the demand. Therefore, it is very difficult to predict total demand within a period accurately even week-by-week or item-by item.High zest purchasing the availability of the products increases the need for the customer to buy it. Consumers decision qualification for buying fashion clothes occur at the point of purchase.4. 1. 2. 3. Key Success Factors for Fashion IndustryTo conclude, as the fashion products have a short life cycle and as it is difficult to predict the market demand due to unstable demand as well as characteristics of fashion market, several key success factors were identified. These are outlined belowPrice Prices should be affordable for the customers.Quality F ashion products should have a good quality.Quick Response Companies should respond to market demand right away by launching rapidly.Design Should match with the current fashion.Availability Products should be available on the shelves of the store as long as there is demand.Variety Companies should provide variety of products for the customers.4. 1. 2. PESTLE AnalysisPESTLE framework provides a comprehensive list of environmental influences on the possible success or failure of particular strategies (Johnson et al., 2008). PESTLE framework contains six factors, which are the external factors that have effect on companies. It is argued that if companies major these factors they can formulate strategies from the opportunities or be prepared for the threats.4. 1. 2. 1. P Political FactorsSince 2005, no restrictions left(a) on all import in the textile and clothing industry. This gives open-ended access to all members of the WTO to the European.This would formulate an opportunity for Zara as it imports products from outside the UK with low cost without any restrictions. However it could pose as a threat for Zara, as the competition in the market can be increased especially by the companies which have products with lower prices.4. 1. 2. 2. E Economic Factors virtually recent recession hit almost all countries in the world, including the UK. As a result of global recession, the unemployment rate in UK started to increased. According to the discipline Statistics (2009), the unemployment rate was 7.6% for the first quarter of 2009 and it was the highest rate since 1981.The impact of recession in the UK is a threat for Zara, as the number of un assiduous people increase, their expenditures decrease. Moreover, for employed people, current economic conditions bring uncertainty and therefore they tend to decrease their expenditures and increase their saving. This could affect Zaras sales in an adverse way since unemployment rate has been on the rise.Moreover, as a re sult of economic recession, the Gross municipal Product (GDP) has been declining in a dramatic way in the UK. According to the National Institute of Economic and Social Research (2009), the GDP in the UK fell by 0.3% ending in July 2009 in addition, according to monetary Times (2009), it was the worst quarterly performance since 1958. However it is predicted that it rose by 0.2% starting from August.Decline in the GDP posed a threat for Zara as it indicates decline in consumers income.In terms of exchange rates, the seat is also not that bright. According to Economy Watch Website (2009), since December 2008, the swell Britain Pound (GBP) lost value at a rapid rate and reached a 24-year low of $1.35 per 1 in January 2009.The impact of weakening of the smite against euro and dollar is pushing up the prices of imports and therefore forces retailers to increase their prices. According to Financial Times (2009), this would formulate a threat for Zara as the retailer will need to inc rease its prices. However, depreciation of GBP would be an opportunity for the mother company Inditex because of the strong Euro against the GBP. More interestingly, despite the recession, the clothing industry in the UK is lighten growing. In general, the retail industry in UK has grown during 2009 and the growth was preponderantly in non-food goods particularly in textile, clothing and footwear stores by 11.3% (National Statistics, 2009b).4. 1. 2. 3. S Social FactorsThe social factors are one of the most important factors which affect the fashion industry. Culture of the society is viewed as the most significant factor in terms of its effects in fashion since it is different from one country to another, even it might be different in the same country. Moreover, culture changes as time passes and these changes affect preferences in fashion. As a result, predicting changes become difficult since taste of consumes can be influenced by several factors, such as weather, movies, or eve n footballers or pop stars (Christopher et al., 2004).The impact of this would be a threat for all companies in fashion industry if they company cannot be able to adapt themselves with ever-changing nature of tastes.Other thing which might affect fashion preferences is education which triggers continuous searching for knowledge. In the UK, education level is high and it causes fashion preferences change rapidly. This is because, as a result of high education level, the awareness of customers to new areas of experience expands and it increases the interest in and desire for a more fashionable appearance. Moreover, increases in the number of working women let them more confident in their judgments when making decisions about clothing (Kiran et al., 2002).The increase in population in the UK is also an opportunity for Zara. According to National Statistics (2009), the UKs population increase with an annual growth rate of 0.5% which is about 1000 people per day due to increase in number of births. This means the market for fashion clothing will continue to grow thanks to the increase in the number of customers, particularly in children clothing sector.UK clothing market is well-developed market and it is growing. According to the research conducted by Allwood et al. (2006), consumers in the UK spent 38.4 billion in 2005 in clothing and of which 24 billion was on womens, girls and infants clothing and 12 billion on mens and boys clothing. Growing fashion clothing market is an opportunity for Zara, especially in women and girls sectors.To conclude, it can be said that the impact of the social factors on Zara would be positive as they create opportunity for the company if it quickly responds to the market and the changing in customer preferences.4. 1. 2. 4. T Technological FactorsThe technology is the receding stone for any company since it helps in decreasing the cost in manufacturing process. Therefore, technological developments stand as an opportunity for Zara as advance technology helps in developing better business process.In addition to this, technology led to development of new marketing channels. The internet is a good example for such development. Recent figure showed that online retailing has been increasing particularly in the UK. According to IMRG Cap Gemini (2009), e-retail sales index showed an increase around 12% in the second half of 2009 and in the first half o 2009, UK consumers spent 22.9 billion in their online purchases. This suggests that increase in online retailing transactions stands as an opportunity if Zara starts online retailing.4. 1. 2. 5. E Environmental FactorsWatson (2001) argued that as much as organic food products have become popular, it is inescapable that consumers will extend their scope of purchase to the organic textiles and this trend is already started as some retailers such as Marks and Sp